Yo no tuve infancia;
tuve prehistoria
el PaleoFreak
Blog sobre evolución y temas afínidos



Comentarios recientes

El Libro:

Una carta, no demasiado cordial, a un creata.
Comprar el libro.
Colección ¡Vaya Timo!


Buscar en el blog

El Comentárido:

Ver más comentáridos

Libro recomendado

Más libros recomendados


Escribe al PaleoFreak


cotillear las estadísticas

Gracias a:


Temas varios

Más dinosaurios ¿?

ATENCIÓN: esto fue una broma con motivo del Día de los Santos Inocentes

Como habréis notado los habituales, el blog se actualiza últimamente con muy poca frecuencia y esto no se debe a la presión del trabajo en la vida real ni a las tareas reproductivas, sino a la desgana. Es así, qué le vamos a hacer. Estoy cansado. Sobre todo estoy cansado de los dinosaurios. De hecho, he llegado al punto en que me tocan mucho los cheurones los dinosaurios. Los odio. Os odié a vosotros cuando en aquella encuesta sobre los temas que más os gusta ver tratados aquí, la mayoría dijísteis "más dinosaurios". Lo mismo ocurre en Plasticosauria. Tengo cocodrilos caníbales, serpientes cabezonas, interesantísimos dragones, lagartos absurdos, monstruos de varias cabezas... pero queréis más dinosaurios. Los nenes quieren dinosaurios. No soporto tener lectores tan infantiles, y siento ser así de sincero.

¿Qué queréis? Queréis que esté todas las semanas escribiendo cosas como: "Hallan en Pedrasquillo del Hoyo un nuevo dinosaurio saurópodo igualito a todos los otros miles de puñeteros dinosaurios saurópodos, pero con el fémur más gordo. Los restos, muy incompletos, constan de un fémur gordo. Ha sido bautizado Pedrasquillodelhoyosaurus fernandezi" en honor al señor Crescencio Fernández, dueño de la finca en la que se halló el fémur gordo."

No, no puedo más con esto. Voy a reflexionar sobre el futuro del blog en los próximos meses y ya veremos. Mientras tanto dedicaré el escaso tiempo libre a mis auténticas pasiones: el deporte, las insignias militares, y el movimiento 15M. Sí: colaboro en la asamblea de mi barrio dando abrazos para interrumpir (de buen rollo) a los ciudadanos que se pasan un poco en su turno de palabra o empiezan a decir demasiadas idioteces. También repartía dinosaurios de goma sobrantes a los niños de un hospital, pero eso se acabó.

2011-12-28 | Haz un comentario (hay 113)

Etiquetas: , ,

Referencias (TrackBacks)

URL de trackback de esta historia http://paleofreak.blogalia.com//trackbacks/70999


De: Kanaima Fecha: 2011-12-28 12:58

Feliz 28 de diciembre!!

De: Gargotaire Fecha: 2011-12-28 13:01

Me hizo mas gracia el Homo intellegans :p

De: Jomarori Fecha: 2011-12-28 13:01

Yo, hables o no con frecuencia de dinosaurios, mientras el blog hable de temas de paleontología seguiré leyéndolo. Y si necesitas un descansito tómatelo, hombre, todo el mundo necesita alguno alguna vez.

De: Sr. Hammond Fecha: 2011-12-28 13:40

tacatacatacatacatacatacatacata (helicóptero)

Aterrizo en tu excavación de deinonychus. Abro la botella de champán que estabas reservando. Te iba a invitar a un parque temático «justo echo a tu medida».

Pero si ya no te gustan los dinosaurios… Pues tendré que llevarme a dos borrachos para que acompañen a un matemático, un abogado y dos niños a dar paseos a lomos de un braquiosaurio mientras se los intenta comer un tiranosaurio.

¡Larga vida a los dinosaurios! ¡Welcome to Jurassic Park!

De: Hexo Fecha: 2011-12-28 13:42

Podrías montar un blog sobre insignias militares, le veo mucho potencial.

De: Pablo Lara Fecha: 2011-12-28 15:15

Muy buena inocentada!

De: JoseLuis Fecha: 2011-12-28 17:25

Osea que has visto la luz y has comprendido que todas las especies fueron creadas por Dios hace cuatro mil años (o así) y los huesos de tus dinosaurios son engaños del maligno para hacerte caer en el error.

De: Papa Gallo Fecha: 2011-12-28 17:50

Hazte creacionista, mola mucho más que las insignias militares... y se liga mucho más.

De: FXavier Fecha: 2011-12-28 17:50

¡Vaya, qué oportuno!
Me han encargado que escriba el guión de una superproducción sobre dinosaurios y había pensado en ti como asesor científico. El sueldo era más que que fastuoso, casi obsceno.
A otro le pediría que reconsiderase su posición y aceptase el trabajo, pero sé que eso es impensable en un hombre de principios como tú.

¡A ver dónde encuentro ahora el substituto! Repasaré tus posts buscando a los que más discutían contigo. Algo tienen que saber sobre el tema.

De: El PaleoFreak Fecha: 2011-12-28 17:56

"sé que eso es impensable en un hombre de principios como tú"

:o |

De: Hugweyn Fecha: 2011-12-28 17:57

Como participante del movimiento 15-M, me siento ofendido.
No, es coña, la verdad es que hay algunos plastas con afán de protagonismo.
Cuatromil y pico millones de años dan para mucho. HAbla un poco más sobre... no sé, la explosión cámbrica, por ejemplo.

De: Casi Anónimo Fecha: 2011-12-28 18:00

Pobre, ha perdido la ilusión, ya no le gustan los dinosaurios, tan sólo los pterosaurios, euriápsidos, sinápsidos, la fauna de Ediacara, del Burgess Shale, las tortugas ninja,los creodontos y otras bestias antediluvianas salidas del Tártaro.

He venido a ver esto en cuanto me he enterado de que era 28 x)

De: ome Fecha: 2011-12-28 18:00

He picado!!!! Hasta lo de las insignias militares, me lo estaba creyendo

De: Epicureo Fecha: 2011-12-28 18:27

¡No! ¡Noooooo! ¡NOOOOOOOOO!

Me lo llegué a creer hasta que llegué a lo de las insignias militares. Muy bueno.

De: Ryouga Fecha: 2011-12-28 18:36

Ya se que estas aburrido de todo esto pero, podrias al menos pasarnos el enlace al documento que describe el femur gordo de Pedrasquillo del Hoyo?

De: El Plasticosauriólogo Fecha: 2011-12-28 19:15

Pero insignias militares mundiales? Catalanas? Históricas? Nudibranquiales? Por favor, muéstrame el camino, ahora me siento perdido, debo seguirte en tus 'nuevas pasiones'. También en del deporte, que no sé cómo se hace. Del 15M ya domino algo, no he repartido abrazos (oh! gran gesto! también quiero uno!), pero sí que he simpatizado con ellos :)

De: Carcharhinus Fecha: 2011-12-28 19:23

El segundo párrafo me ha encantado, no cambies Paleo, que se agradecen tus toques sarcásticograciósicos así como el aprendizaje que ofreces en paleontología, biología y filogenia.

Muchas gracias. Feliz navidad, año nuevo y que Oviraptor se coma un huevo.

De: velocirrapta Fecha: 2011-12-28 19:27

El mejor y mas divertido blog de dinosaurios

De: D.E.L Fecha: 2011-12-28 19:45

Jajajaja...casi pincho paleofreak xDDD
Venga, eres el Raúl de los blogs de paleontología en castellano... NUESTRO CAPITÁN ETERNO!!!!
Pase lo que pase, siempre, tu blog será la referencia siempre, porque es el pionero. Arcaico, cierto. Pero sigue siendo un auténtico fósil viviente. ERES LA LECHE PALEOFREAK!!!!

pd:Dentro de nada los 10 años de esta web ehh!!!... y mis 6 años siguiendola, tal vez de lo primero que visité en internet... GRANDE!!

De: LOL Fecha: 2011-12-28 19:52

Pues de broma en broma la verdad se asoma, el PaleoFreak ya no ha posteado nada nuevo sobre dinosaurios ni paleontologia, ahora todo es creacionismo y plasticosaurios, como si el mundo necesitara más de ello

De: El PaleoFreak Fecha: 2011-12-28 20:27

No es cierto: mira el archivo de historias.
De todas formas, si tuviera que poner en el blog lo que "el mundo necesita", apaga y vámonos.

De: El PaleoFreak Fecha: 2011-12-28 20:31

Muchas gracias, D.E.L.
Aunque no entiendo eso de Raúl ¿qué Raúl?
Raúl tiene un baúl azul
y dentro del baúl azul tiene Raúl
una pierna de madera que de un tio abuelo era,
un tricornio, una chistera,un traje de lagartera
y frasquito de alcanfor,
del mismo color,
azul como el baul.

De: D.E.L Fecha: 2011-12-28 20:45

Boh... xDDDDD
Lo que quería decir es que serás siempre el pionero y tu blog un ejemplo de buena gestión.

De: Luis M. Fecha: 2011-12-28 22:08

"¿Qué queréis? Queréis que esté todas las semanas escribiendo cosas como:..."

Rotundamente ¡no! Queremos que lo hagas ¡todos los días!

De: telonnius Fecha: 2011-12-28 22:15

Esta entrada me ha partido mi pequeño corazón reptiliano.
Te imagino dando abrazos y se me saltan lágrimas cretácicas.

De: Paquicéfala Fecha: 2011-12-29 01:23

¡Nooo! ¡No repartas los plasticosaurios sobrantes a los niños enfermos! ¡Mándamelos a mí! XD

De: Broken Machine Fecha: 2011-12-29 05:06

Jajajajajajaa, este Paleofreak, como me hace cagar de risa, primero con el post y luego con es de Raúl.... pero debo admitir que por 1 segundo me asusaste maldito!!!!!!!

De: Broken Machine Fecha: 2011-12-29 05:06


De: juanele Fecha: 2011-12-29 10:19

Vale tío, yo creía qué emocionaba a la peña con mi discurso. Pues no me vuelvas a abrazar, cortarrollos.

De: José Antonio Peñas Fecha: 2011-12-29 10:20

¿Y los dientes de sable? ¿Es que nadie se acuerda de los dientes de sable, animalicos del señor, pero olvidados de todos?

De: Christoferson Fecha: 2011-12-29 11:56

Man... fuera de bromas no dejas de tener razón en eso de que "descubren saurópodo igual a la chorrera que ud ya conoce...", se ha vuelto un poco monótona la paleo... parece ser.

De: JoseLuis Fecha: 2011-12-29 16:48

Una vez pasado el 28 tengo que decirte que, a pesar de que no había intervenido hasta ayer, te leo todo, todo y todo; y supongo que existirán otros muchos como yo, leyentes silenciosos pero que apreciamos tu blog.

De: Casi Anónimo Fecha: 2011-12-29 17:27

Igualmente por aquí, te observamos desde las sombras...

De: Cuervo Fecha: 2011-12-29 18:19

Yo cuando leí lo de "Deportes" En el Paleofreak, ya sabía que era una inocentada :)
Pero esta inocentada tienes que aceptar que también la escribiste con el enojo que tenemos todos , que los dinosaurios cada vez mas pobres se describen y se le otorgan nombres mas feos y siempre dedicados a personas o lugares.
Muy bien parodiado ;)

De: Anónimo Fecha: 2011-12-30 12:01

Si al comparar a Raúl con el paleofreak estas diciendo que el paleofreak es un muerto viviente con baston y la velocidad de Usain Bolt, NO ESTOY DE ACUERDO. El paleofreak es como un dinosaurio, nunca se extinguira.

De: CaptainAnnoyed Fecha: 2011-12-30 15:36

Jolines, Paleofreak, soy uno de tus lectores habituales "en la oscuridad"; te visito desde hace años, y qué susto, hombre, esto no se hace XD

De: Mort_Adela Fecha: 2011-12-30 20:34

Menudo sustórido con tu comentárido :D

De: D.E.L Fecha: 2011-12-30 20:56

Anónimo...Raúl un muerto viviente??
Lo que quería decir es que siempre es la referencia esté en forma o no!!! Aunque dejara de publicar posts ahora la manera en la que llevó este blog durante casi 10 años (Comentáridos, crítica al creacionismo y la prensa, las secciones...etc) hacen que sea un ejemplo para otros blogs.

PD: El muerto ese que dices, lleva 17 goles con el Schalke este temporada.

De: anónimo que sí es anónimo Fecha: 2011-12-31 10:44

yo soy uno de (imagino que tantos) que te lee asiduamente (no así los comentarios, a no ser que haya una discusión con faltas de ortografía), pero no digo ni mu.
leo tu blog porque sueles explicar con claridad conceptos más bien complejos, y no lo haces como los medios de comunicación (y ya sabemos todos a qué me refiero).
de modo que he de decir que yo (un individuo que no conoces de nada) me llevaría un disgusto si dejases de escribir aquí.
¡tómate un descanso hombre! ¡pero vuelve!

feliz 2012 (CON dinosaurios, claro)

De: anónimo que sí es anónimo Fecha: 2011-12-31 10:47


si estás harto de dinosaurios, piensa en esa escena de American Dad en la que Dios (sí, tu amigo) está jugando con dos muñecos de un triceratops y un tyrannosaurus, y se para a reflexionar:
"eh, estos bichos molan ¿por qué los enviaría a Marte?"

De: anónimo que sí es anónimo Fecha: 2011-12-31 14:20

(rebautizado como lerdo)

tal vez DEBERÍA leer los comentarios, o los encabezados!

bueno, pues antes de volver a mi anonimato, como broma me parece un poco chorra. total, sí tiene que ser un rollo estar actualizando un blog, pero hay gente pa tó.

en fin, me alegro de que sigas, y feliz año a todos

De: Hexo Fecha: 2011-12-31 19:12

Me ha gustado mucho eso de "es como un dinosaurio, nunca se extinguirá" Haha XD

De: Te admiraba.. Fecha: 2012-01-01 18:08

Pues paleofreeak, feliz año y todo, pero me carcome una duda. Tu ya que eres un viejo de 40 y tantos tacos y yo un jóven ¿notas ya que te quedaste en el pasado y no puedes seguir los avances de los dinos y la ciencia? Ya no hablas tan a menudo de la evolución de las aves y los dinos no-avianos. ¿Te están cargando los años? Digo, para prepararme desde ya, porque no quiero terminar como tú. :-(

De: Te admiraba.. Fecha: 2012-01-01 18:18

Por otra parte no hay recambio generacional en este blog, son los mismos avejentados de siempre (bueno, cada vez menos por a quienes tus gruñidos de avejentado fósil les llevaron a otros rincones del mundo) y se torna aburrido, o sea. -(momento mientras suelto una lágrima por aquellos primeros y frescos años entre el 2003-2008)-

Cuando muera este blog (y lo hará inevitablemente), recuerda sólo una cosa..no dedicaste ni una puta entrada para hablar del Jeholornis palmapenis. Abueloooooooooooooooooooooooooooooo!!!

Me despidos y haz de este puto blog un espacio par a los plumíferos, ME CAGO EN 10.

De: Rexisto Fecha: 2012-01-01 20:39

Blog, foros y sitios web que hablan de los cientos de descubrimientos que se dana cada rato hay varios, en chino, en inglés, en español o que se yo. Pero el sitio de Paleofreak nunca ha sido un periódico ni veo que se ponga a complacer a la gente. Simplemente es y será para mi "El Paleofreak"

De: Te admiraba.. Fecha: 2012-01-01 21:20

Pero si ya hasta de bastonazos trata a sus lectores, esta avejentándoseeeeeeeeee. :-O

De: Te admiraba.. Fecha: 2012-01-01 22:05

Y ni siquiera terminaste hablando del trabajo de Lee y Worthy (Likelihood reinstates Archaeopteryx as a primitive bird) cuando haz sacao lo del Archaeopteryx.

¿Qué te ha pasao tío? tú antes molabas, mucho me hajj cambiao.

De: El PaleoFreak Fecha: 2012-01-02 00:49

Lo del Jeholornis palmapenis, y muchas otras cosas breves (una mención, un enlace, una bromilla), las pongo en Twitter. Los abueletes estamos todos allí ;o)
Gracias por otorgarle al blog un tiempo de frescura tan largo: 2003-2008. Creo recordar que ya mucho antes había chavalotes diciendo "no has hablado de esto, qué decepcióooon" :oD

De: Rexisto Fecha: 2012-01-02 05:46

Ok, cierto Paleofreak, lo que si hubiera querido ver en tu sitio es ver el debate que si Archaeopteryx es o no un ave (ya se, que es una discusión inútil, pero el debate se me hizo muy bueno). Al final el término ave puede incluir a los terópodos que cada autor interprete, según la posición filogenética hipotética de cada quien. ¿Que rayos es un ave?

De: FXavier Fecha: 2012-01-02 14:20

Caesar tenia claro que era un Ave

De: velocirrapta Fecha: 2012-01-02 20:12

pues no me quedará mas remedio que irme al Twitter con los otros abueletes, joder!

De: Alma de cantaro Fecha: 2012-01-03 11:43

"Te_admiraba": Te voy a hacer una predicción, que me has cabreao:

Espero que lleves los cuarenta tan mal como llevas los veinte.
Que protestes de todo, gruñas sin parar como un aguafiestas y un sobrado y no haya quien te aguante.

O sea, lo mismo que ahora pero farfullando cada treinta segundos: "Esto antes no pasaba, los jóvenes de estos tiempos no saben hacer la O con un canuto" .

Es el karma, no lo dudes, así serás.

Y además, espero que te jubiles de becario. Ea.

De: JalKeratops Fecha: 2012-01-03 16:57

Feliz Año con todos. Cierto que llevo un tiempo sin comentar por aqui, pero es culpa de la vejez, ya que para mi es el mejor sitio para informarme no solo de dinosaurios. Lo leo pero ya no me da tantas ganas de comentar como antes.
Sigue asi Paleofreak, es año pasado no fue tampoco una mina en descubrimientos nuevos. Sin embargo este alo le falto bastante a la broma., y es claro el error. Uno nace con los dinosaurios y muere con los dinosaurios, por mas que lo intentes, es como si estuviese en el ADN asombrarse con animales prehistoricos, y ninguna desgana los saca.
Off topic: Miraba un documental de dinos que piaban y graznaban como aves, y se me ocurrio ¿Que tanto se sabe sobre las gargantas de los dinosaurios para saber que ruidos hacian? No es para jorobar, solo que no me suena el sonido del Trex, que sonaba a gallina con injerto de cocodrilo.

De: Assarhaddón Fecha: 2012-01-03 18:57

Mientras veo una película rusa sobre la vida de Gengis Khan (con subtítulos, claro), donde salen herejes nestorianos predicando a luciferinos paganos mogoles... todo ello con un estilo narrativo alegórico-simbólico-metafórico-triunfal... Me alegra que hayas puesto en negrita lo de la broma. Eso ahorra mucho comentárido.
No obstante, mientras el niño Temujin ya da signos de haber sido elegido por los dioses, me pregunto cuánto de verdad habrá en que el PF está un poco hasta los cojones del blog.
Muchos buenos blogs están inactivos o han desaparecido. Eso es asín.

De: Pichi Fecha: 2012-01-04 00:26

Uff que bueno que pusieron la nota que era una broma, crei que este blog se estaba llendo por el retrete! :p

De: El PaleoFreak Fecha: 2012-01-04 01:53

"me pregunto cuánto de verdad habrá en que el PF está un poco hasta los cojones del blog"

El blog me sigue encantando. Estoy hasta los cojones de tener poco tiempo para el blog.

De: gualtrapatherion Fecha: 2012-01-04 08:41

Lo de deducir como cantaban (o graznaban, o lo que fuere)los dinosaurios, si nos basamos en las aves actuales, no habría que basarlo en las gargantas (o en los huesos que rodean a las mismas), sino en la bifurcación de la tráquea en los dos bronquios principales, cuyos cartílagos modificados, junto con membranas conectivas que vibran y músculos especiales que lo accionan todo, conforman la siringe, el órgano fonador aviano. Si apareciese un dinosaurio tan bien conservado como para saber como eran esos cartílagos, se podría deducir a partir de las inserciones musculares si el canto era complejo, o por la anchura de la siringe si era grave y profundo, o fino y sibilante, en fin, como friki de los cantos de ave me gustaría bastante.

De: JalKeratops Fecha: 2012-01-04 22:24

Y conociendo la gran capacidad de los cartilagos para fosilizar.... va a tomar algun tiempo para que se de el golpe de suerte. Gracias por aclarme el tema, aunque eso crearia mas problemas a los documentales que cojen a un dinosaurio, y para hacerlo simpatico le meten cualquier ruido. Lo curioso es que ahora recuerdo que los pterodactilos siempre suenan como aguilas, y cualquier reptil marino como ballena con ecos y todo. Ya es tiempo que se pongan la mano en el pecho y hagan sonar a los animales como animales, que por prehistoricos deben sonar , pues no se diferentes.

De: JalKeratops Fecha: 2012-01-04 22:31

Me molan mas si suenan graves y profundos, asi como en plan de ensayo de canto, no creo que se desarrollara tan temprano el canto y en consideracion del tamaño de algunos (aunque escuchar algo como un Diplodocus tratando de trinar no me cuadra). Y los hadrosauridae estos con esas crestas rezumbadoras, o amplificadoras si deben haber metido una bulla tipo concierto de opera.

De: gualtrapatherion Fecha: 2012-01-05 08:22

A mí las crestas de los hadrosaurios me recuerdan (salvando las obvias distancias) al esternón de la grulla euroasiática, en esta especie la tráquea, en vez de entrar directamente en la cavidad torácica, se empotra en el esternón, muy engrosado y hueco, y da dos vueltas (en plan trombón de varas) hasta volver a salir por la parte anterior y ya dividirse en los dos bronquios, el intrumento de viento con caja de resonancia resultante es lo que hace que el "gruu" se escuche desde km de distancia. En las anátidas las paredes de la siringe se hallan prácticamente osificadas, estructuras como estas podrían fosilizar... Y respecto a la antigüedad del canto, especies con vida social compleja es muy probable que desarrollasen vocalizaciones también complejas. Incluso entre las casi silenciosas tortugas hay una especie del SE asiático, Manouria emys, que emite una serie de sonidos, distintos a lo largo d ecada fase del ritual de apareamiento, y que han sido descritos y catalogados, así que yo no aseguraría que algunos dinosaurios no fueran capaces, al menos, de lo mismo.

De: eledhwen Fecha: 2012-01-07 13:58

Suscribo lo de los "Diente de sable". (Y parentela varia).

De: Bob Esponja Fecha: 2012-01-23 18:58

Mi primer comentario en este blog (ver "Seguíamos subestimando la diversidad") y he caído como un primo.
¿Alguien me puede recomendar una buena página de creacionismo? Estoy dispuesto a tragármelo todo (abstenerse bromistas y amantes de segundos sentidos. Si fuera por ahí me habría metido en otra página)

De: Calamardo Tentáculos Fecha: 2012-01-26 23:22

Ministerios antes del fin

De: Bob Esponja Fecha: 2012-02-02 18:27

¡¡¡He he he!!!
Muchas gracias Calamardo. Me ha encantado la página sobre el Archaeopteryx, donde el Pastor Ureña dice que los científicos son "dueños de los canales de TV, las revistas, los medios, los periódicos, las universidades, las escuelas y todos sus gremios, así como las cortes."

Ahora ya sé lo que quiero ser de mayor: ¡Voy a ser científico!
¡Por fin cumpliré mi sueño de dominar el mundo! ¡Jua, jua, jua, jua!

De: Gris93 Fecha: 2012-02-04 05:19

Ya me estaba comenzando a parecer raro...ojalá no desaparezca este blog, lo vengo leyendo desde hace 4 años, solo que recién me animo a comentar..

De: yicela Fecha: 2012-02-04 19:34

yo no creo oe k voleta parce

De: sebastian Fecha: 2012-03-12 18:47

me encanta el sentido sarcástico de tu edición, y como manoseas a los creacionistas(me considero creyente, pero no creata, ya encontrare algo que me acomode). los temas que abordas son muy interesantes, y siempre me tomo tiempo para leer tu blog(es uno de mis favoritos). lamento que te aburra el tema dinosauriano, pero me encantaría que abordaras temas de invertebrados con mas frecuencia, te lo digo como sugerencia. y si mi opinión te vale un céntimo, da lo mismo. igual me caes bien. saludos y animo, siempre habrá algo de que conversar.

De: Natalia Fecha: 2012-06-10 23:42

De broma en broma la verdad se asoma;)

De: Shoreline Amphitheatre tickets Fecha: 2019-01-16 16:43

I have to convey my respect for your kindness for all those that require guidance on this one field. Your special commitment to passing the solution up and down has been incredibly functional and has continually empowered most people just like me to achieve their dreams. Your amazing insightful information entails much to me and especially to my peers. Thanks a ton; from all of us.

De: 안전놀이터 Fecha: 2019-03-09 22:11

I like what you guys are usually up too. This type of clever work and reporting! Keep up the great works guys I’ve incorporated you guys to my blogroll. 안전놀이터

De: jack Fecha: 2019-03-12 16:40

For this reason it's prudent that you can acceptable homework leading up to publishing. You may establish better print in this manner. VIP Financing Solutions Reviews

De: escorts in faridabad Fecha: 2019-03-27 11:31

If you are interested for romance with hot girl you can contact me any where. Thanks for visited.

||Call girls in Faridabad||
||escorts in Faridabad||
||Faridabad escorts||

||Faridabad escorts service||
||escort service in Faridabad||
||call girl Faridabad||

||Faridabad call girls||
||Faridabad escort service||
||independent escorts in Faridabad||

||independent call girls in Faridabad||
||high profile call girls in Faridabad||
||Russian escorts in Faridabad||

||college call girls in Faridabad||
||college escorts in Faridabad||
||air hostess escorts in Faridabad||

||escort agency in Faridabad||
||vip russian escorts in faridabad||
|| vip escorts services in faridabad||

De: call girls in faridabad Fecha: 2019-03-27 11:36

If you're seeking Faridabad independent Escorts Agency then Call us to rent the best VIP Escorts in Faridabad. Get very hot erotic sex services 24/7 Hours.

||call girls in faridabad||
||faridabad escorts||
||faridabad escort||

||faridabad call girls||
||faridabad call girl||
||faridabad escort agency||

||escort services in faridabad||
||faridabad escort service||
||housewife escorts in faridabad||

||college escorts in faridabad||
||russian escorts in faridabad||
||college call girls in faridabad||

||independent escorts in faridabad||
||independent call girls in faridabad||
||high profile escorts in faridabad||

||call girls in Ballabgarh||
||call girls in Surajkund||
||call girls in Greenfield||

De: 안전공원 Fecha: 2019-04-12 17:53

I love the many content and articles, I have to tell you document highly valued, Document would really like more details on the subject of this approach, because it is known it is very awesome., With thanks on the subject of exposing.

De: jack Fecha: 2019-04-14 11:12

Although my partner and i purchased on your own net sign nonetheless incorporating consciousness just a bit feel submits. Great technique for prospective, We have been book-marking within a period of time locate variants deduce spgs approach upwards. como espiar whatsapp

De: asim Fecha: 2019-04-15 23:59

There are a lot dissertation internet websites via the web as soon as you look for not surprisingly listed as part of your article. Marion County FL real estate

De: jack Fecha: 2019-04-18 22:41

That definitely possibly an amazing organize i always in truth definitely relished checking out. It's not necessarily specifically frequent i always add some choice to identify a selected matter. Bitcoin

De: rent a appointment Fecha: 2019-05-01 12:19

This kind of actually also a good placed that we in reality actually appreciated looking into. It isn't automatically typical that we are the substitute for establish a certain factor.

De: florida commercial building contractor Fecha: 2019-05-14 09:21

To check out become in your blog nevertheless environment remedy obviously merely a small little submits. Reasonable way of possible long term, We're book-marking at a time safe types cease increases collectively.

De: Kodi jailbreak Firestick Fecha: 2019-05-19 10:30

There are plenty of dissertation web sites over the internet while you obtain not surprisingly detailed in the webpage.

De: jack Fecha: 2019-05-20 22:28

For this reason it's best that you need to suitable analysis just before creating. You'll be able to produce far better submit as a result. click to read

De: jack Fecha: 2019-05-25 20:20

I need your position. It is really finer quality than see anyone explain in words from the basis in addition to legibility for this issue needed place are generally handily found. http://gecey.com/15-inch-tv/

De: slime satisfying Fecha: 2019-07-26 02:51

Well, you are not decadent. Social networks were to blame. You never managed to be like Tetrapod Zoology.

De: slime satisfying Fecha: 2019-07-26 02:51

Well, you are not decadent. Social networks were to blame. You never managed to be like Tetrapod Zoology.

De: Arby’s menu Fecha: 2019-08-08 18:05

Thank you for your work on the blog! You're doing a good job!

De: Naveed Fecha: 2019-08-29 15:02

Thank you so much Love your blog..
Smarter Security CCTV

De: ASIM Fecha: 2019-09-03 10:11

Much more than cooking goes on in the kitchen, and you need multiple layers of light. hampton bay

De: Naveed Fecha: 2019-09-04 14:23

This is very educational content and written well for a change. It's nice to see that some people still understand how to write a quality post.!
instagram likes

De: ASIM Fecha: 2019-09-05 10:42

Watch TV shows online in HD quality without registration 123 movies

De: Naveed Fecha: 2019-09-08 16:26

I just couldn't leave your website before telling you that I truly enjoyed the top quality info you present to your visitors? Will be back again frequently to check up on new posts.
hampton bay

De: Naveed Fecha: 2019-09-11 12:41

This is my first time i visit here and I found so many interesting stuff in your blog especially it's discussion, thank you.
Workout Clothing on Sale

De: ASIM Fecha: 2019-09-12 10:49

Thanks for sharing the post.. parents are worlds best person in each lives of individual..they need or must succeed to sustain needs of the family.
عبد واب

De: Naveed Fecha: 2019-09-12 13:15

Thanks for sharing the post.. parents are worlds best person in each lives of individual..they need or must succeed to sustain needs of the family.
qibla finder

De: ASIM Fecha: 2019-09-12 22:50

Wow i can say that this is another great article as expected of this blog.Bookmarked this site..
hampton bay

De: Arpit Sharma Fecha: 2019-09-14 10:47

Thank you for posting such a great article! I found your website perfect for my needs. It contains wonderful and helpful posts. I hope you continue to have such quality articles to share with everyone! Hotel Booking Engine

De: ASIM Fecha: 2019-09-14 21:22

Are you a seafood fanatic who wants to try Malvani food in Mumbai? If yes, you have landed on the right page. I will enlist 5 best places to eat best malvani food in mumbai . While Malvani cuisine already makes our mouths water

De: ASIM Fecha: 2019-09-15 15:30

If you have heard about home depot survey but you are not so sure about it or what it does then you are in the right place. homedepot survey

De: ASIM Fecha: 2019-09-17 10:24

Pavin Chachavalpongpun, associate professor at the Centre for Southeast Asian Studies at Kyoto University, told AFP that he believes martial law was simply a prelude to the military taking full control.

De: ASIM Fecha: 2019-09-18 15:04

The main reasons why are to save time, money and resources. It helps to reduce and control the costs. AFFORDABLE CUSTOM PAPER WRITING SERVICE

De: ASIM Fecha: 2019-09-19 17:06

We offer Dissertation writing help, Writing a research proposal & easiest way to write an essay fast

De: ASIM Fecha: 2019-09-20 14:01

Get your custom assignment in 5easy steps ACADEMIC WRITING SERVICE FOCUSED ON LAW AND FINANCE

De: ASIM Fecha: 2019-09-21 13:25

"Your Files Go, Wherever You Go!"
FTP Web Space

De: ASIM Fecha: 2019-09-23 01:48

Thanks for sharing us. Care Chiropractic Massage

De: Naveed Fecha: 2019-09-24 15:34

Thanks for posting this info. I just want to let you know that I just check out your site and I find it very interesting and informative. I can't wait to read lots of your posts.

De: ASIM Fecha: 2019-09-30 08:04

That is really nice to hear. thank you for the update and good luck.
Carpet cleaning Fayetteville NC

De: ASIM Fecha: 2019-10-04 06:55

It was wondering if I could use this write-up on my other website, I will link it back to your website though.Great Thanks. tylebongda

De: asimseo Fecha: 2019-10-04 13:08

Thanks for sharing this useful info..

De: ASIM Fecha: 2019-10-05 05:50

Excellent and very exciting site. Love to watch. Keep Rocking.
Richmond movers

De: asimseo Fecha: 2019-10-05 15:29

Wow i can say that this is another great article as expected of this blog.Bookmarked this site..
Airport Service

De: asimseo Fecha: 2019-10-08 06:42

Great articles and great layout. Your blog post deserves all of the positive feedback it’s been getting.
transfer pf amount

De: Naveed Fecha: 2019-10-08 12:41

This is a truly good site post. Not too many people would actually, the way you just did. I am really impressed that there is so much information about this subject that have been uncovered and you’ve done your best, with so much class. If wanted to know more about green smoke reviews, than by all means come in and check our stuff.

De: asimseo Fecha: 2019-10-10 07:37

It is a great website.. The Design looks very good.. Keep working like that!.

De: Naveed Fecha: 2019-10-13 14:28

This is very interesting content! I have thoroughly enjoyed reading your points and have come to the conclusion that you are right about many of them. You are great.

Dirección IP: (2018ab1077)
¿Cuánto es: diez mil + uno?

Inicio > Historias > Más dinosaurios ¿?

©2016 El PaleoFreak

Subir | Portada | Archivos

"Si la miseria de nuestros pobres no es causada por las leyes de la naturaleza, sino por nuestras instituciones, qué grande es nuestro pecado"
(Charles R. Darwin)